Processing this assembly,
BSMAP
./bsmap -a /Volumes/NGS\ Drive/NGS\ Raw\ Data/Oyster_BSseq/filtered_Unlabeled_NoIndex_L003_R1.fastq -d /Volumes/Bay3\ scratch/tmp/cgigas_alpha_v013.fa -o /Volumes/Bay3\ scratch//tmp/BSMAP_output_trimmed_v0_1_3.sam -p 1 -A AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -z 64
BSMAP v2.42
Start at: Wed Mar 7 12:06:42 2012
Load in 206 db seqs, total size 4749391 bp. 1 secs passed
total_kmers: 43046721
Create seed table. 2 secs passed
max mismatches: 2 max multi-hits: 100 max Ns: 5 seed size: 16 index interval: 4
quality cutoff: 0 base quality char: '@'
min fragment size:28 max fragemt size:500
start from read #1 end at read #4294967295
additional alignment: T in reads => C in reference
param.chains:0
mapping strand: ++,-+
adapter sequence1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Single read alignment(1 threads)
Query: /Volumes/NGS Drive/NGS Raw Data/Oyster_BSseq/filtered_Unlabeled_NoIndex_L003_R1.fastq Reference: /Volumes/Bay3 scratch/tmp/cgigas_alpha_v013.fa Output: /Volumes/Bay3 scratch//tmp/BSMAP_output_trimmed_v0_1_3.sam
Total number of aligned reads: 5603121 (4%)
Done.
Finished at Wed Mar 7 12:43:09 2012
./bsmap -a /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq -d /Volumes/Bay3\ scratch/tmp/cgigas_alpha_v013.fa -o /Volumes/Bay3\ scratch//tmp/
BSMAP_output_trimmed_v0_1_3_B.sam -p 1 -A
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Load in 206 db seqs, total size 4749391 bp. 0 secs passed
total_kmers: 43046721
Create seed table. 3 secs passed
max mismatches: 2 max multi-hits: 100 max Ns: 5 seed size: 16 index interval: 4
quality cutoff: 0 base quality char: '!'
min fragment size:28 max fragemt size:500
start from read #1 end at read #4294967295
additional alignment: T in reads => C in reference
param.chains:0
mapping strand: ++,-+
adapter sequence1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Single read alignment(1 threads)
Query: /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq Reference: /Volumes/Bay3 scratch/tmp/cgigas_alpha_v013.fa Output: /Volumes/Bay3 scratch//tmp/BSMAP_output_trimmed_v0_1_3_B.sam
Total number of aligned reads: 5611746 (4%)
Done.
Finished at Wed Mar 7 14:02:24 2012
Total time consumed: 3787 secs
./bsmap -a /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq -d /Volumes/Bay3\ scratch/tmp/cgigas_alpha_v013.fa -o /Volumes/Bay3\ scratch//tmp/
BSMAP_output_trimmed_v0_1_3_C.sam -p 1
139660651 reads finished. 1888 secs passed
Total number of aligned reads: 5545572 (4%)
Done.
Finished at Wed Mar 7 14:49:41 2012
Total time consumed: 1888 secs
SAM file can be viewed in Tablet
following Bee paper
./bsmap -a /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq -d /Volumes/Bay3\ scratch/tmp/cgigas_alpha_v013.fa -s 12 -v 5 -k 6 -o /Volumes/Bay3\ scratch//tmp/BSMAP_output_trimmed_v0_1_3_D.sam -p 1
#fail no such thing as -k
BAM output
./bsmap -a /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq -d /Volumes/Bay3\ scratch/tmp/cgigas_alpha_v013.fa -o /Volumes/Bay3\ scratch//tmp/BSMAP_output_trimmed_v0_1_3_A.bam -p 1
BSMAP v2.42
Start at: Thu Mar 8 13:38:27 2012
Load in 206 db seqs, total size 4749391 bp. 1 secs passed
total_kmers: 43046721
Create seed table. 11 secs passed
max mismatches: 2 max multi-hits: 100 max Ns: 5 seed size: 16 index interval: 4
quality cutoff: 0 base quality char: '!'
min fragment size:28 max fragemt size:500
start from read #1 end at read #4294967295
additional alignment: T in reads => C in reference
param.chains:0
mapping strand: ++,-+
Single read alignment(1 threads)
Query: /Volumes/Bay3/Software/bismark_v0.6.4/filtered_Unlabeled_NoIndex_L003_R1wID_trimmed.fastq Reference: /Volumes/Bay3 scratch/tmp/cgigas_alpha_v013.fa Output: /Volumes/Bay3 scratch//tmp/BSMAP_output_trimmed_v0_1_3_A.bam
Total number of aligned reads: 5545572 (4%)
Done.
Finished at Thu Mar 8 14:40:53 2012
Total time consumed: 3746 secs
Converting SAM to BAM ...
/Volumes/Bay3 does not exist.
robertsmac:bsmap-2.42 sr320$
OUTPUT
_
methratio
python methratio.py -d cgigas_alpha_v013.fa -z -o OUTz_methratioBSMAP_v013.txt -s /Volumes/Bay3/Software/samtools BSMAP_output_trimmed_v0_1_3.sam
@ Wed Mar 7 17:40:58 2012: reading BSMAP_output_trimmed_v0_1_3.sam …
[samopen] SAM header is present: 206 sequences.
Parse error at line 232: sequence and quality are inconsistent
@ Wed Mar 7 17:40:58 2012: writing OUTz_methratioBSMAP_v013.txt ...
@ Wed Mar 7 17:41:00 2012: Done!
python methratio.py -d cgigas_alpha_v013.fa -z -o OUTz_methratioBSMAP_v013_C.txt -s /Volumes/Bay3/Software/samtools BSMAP_output_trimmed_v0_1_3_C.sam
robertsmac:bsmap-2.42 sr320$ python methratio.py -d cgigas_alpha_v013.fa -z -o OUTz_methratioBSMAP_v013_C.txt -s /Volumes/Bay3/Software/samtools BSMAP_output_trimmed_v0_1_3_C.sam
@ Thu Mar 8 05:12:58 2012: reading reference cgigas_alpha_v013.fa ...
@ Thu Mar 8 05:12:58 2012: reading BSMAP_output_trimmed_v0_1_3_C.sam ...
[samopen] SAM header is present: 206 sequences.
@ Thu Mar 8 05:13:34 2012: read 10000000 lines
@ Thu Mar 8 05:14:16 2012: read 20000000 lines
@ Thu Mar 8 05:14:57 2012: read 30000000 lines
@ Thu Mar 8 05:15:37 2012: read 40000000 lines
@ Thu Mar 8 05:16:15 2012: read 50000000 lines
@ Thu Mar 8 05:16:53 2012: read 60000000 lines
@ Thu Mar 8 05:17:31 2012: read 70000000 lines
@ Thu Mar 8 05:18:08 2012: read 80000000 lines
@ Thu Mar 8 05:18:47 2012: read 90000000 lines
@ Thu Mar 8 05:19:27 2012: read 100000000 lines
@ Thu Mar 8 05:20:05 2012: read 110000000 lines
@ Thu Mar 8 05:20:40 2012: read 120000000 lines
@ Thu Mar 8 05:21:18 2012: read 130000000 lines
@ Thu Mar 8 05:21:54 2012: writing OUTz_methratioBSMAP_v013_C.txt ...
@ Thu Mar 8 05:22:05 2012: Done!
Output
